BIOL_A108 Module 2 Bioinformatics Exercise: Sequence Alignment LAB25 pts. Individual, due week 8 W/Th. in lab. You can collaborate with your group.Name: Section/TA:1. (25pts.) Sequence search by alignment (BLAST). You designed primers targeting a human mitochondrial gene (COX1) and you run PCR on ancient DNA found in a paleolithic cave in France. You see a 700bp amplicon on gel electrophoresis. This is the Sanger DNA sequence of your 700bp PCR amplicon:>MY_CAVE_DNA_SEQUENCE_700bpATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACATTGGAACACTATACCTACTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCTCTAAGCCTCCTTATTCGAGCCGAACTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGGGGCTTTGGCAACTGACTAGTTCCCTTAATAATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAATATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTGCTCGCATCTGCTATAGTGGAAGCCGGCGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAGCAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATTAATATAAAACCCCCTGCCATAACCCAATACCAAACGCCCCTTTTCGTCTGATCCGTCCTAATCACAGCAGTCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGACCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCAGTACCTATT(a) What organism do you expect your sequence to be from? Why? Why might it actually be the DNA of another organism?(b) BLAST your sequence at NCBI BLAST to search against all possible DNA sequences reported. Input your sequence (query) with Parameters: Database standard (nr/nt) – to try all sequences as subjects (unbiased), and Optimize for: Somewhat similar sequences (blastn) – to allow for mismatches. BLAST is at the link: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn
Delivering a high-quality product at a reasonable price is not enough anymore.
That’s why we have developed 5 beneficial guarantees that will make your experience with our service enjoyable, easy, and safe.
You have to be 100% sure of the quality of your product to give a money-back guarantee. This describes us perfectly. Make sure that this guarantee is totally transparent.
Read moreEach paper is composed from scratch, according to your instructions. It is then checked by our plagiarism-detection software. There is no gap where plagiarism could squeeze in.
Read moreThanks to our free revisions, there is no way for you to be unsatisfied. We will work on your paper until you are completely happy with the result.
Read moreYour email is safe, as we store it according to international data protection rules. Your bank details are secure, as we use only reliable payment systems.
Read moreBy sending us your money, you buy the service we provide. Check out our terms and conditions if you prefer business talks to be laid out in official language.
Read more